Skip to main content
Close Search
COVID-19 Updates: Stay Informed

Grain Size Project

Seed / Grain size flow chart

CRISPR-based genome editing of grain size regulators for novel variation to increase wheat genetic yield potential


  • PD: Wanlong Li Institution: South Dakota State University
  • Co-PD: Bing Yang Institution: Iowa State University

Grain size (GS) is the major driver for further growth of wheat yield. Much progress has been made in dissecting the genetic network regulating GS in the model plants rice and Arabidopsis, wherein more than half of the underlying genes are negative GS regulators or negatively regulated by microRNAs. But little is known about GS regulation in wheat. This knowledge gap significantly limits our effort to improve wheat yield. Hypothesizing that conserved genetic pathways underlie GS variation in rice and wheat, we teamed up with expertise in wheat genetics/genomics and genome editing to address Area Priority 1 of this NIFA-IWYP program (A1142) by creating novel variation of the negative GS regulators using CRISPR-based technology for significant increase of genetic yield potential. Our objectives include:

  1. Develop an improved CRISPR/Cas9 system for editing GS candidate genes;
  2. Identify mutations in the GS candidate genes;
  3. Characterize the effect of mutations on GS; and
  4. Transfer beneficial mutations into elite durum wheat.

We have optimized the CRISPR/Cas9 system for high-efficiency genome editing in wheat, identified 32 GS candidate genes in wheat genome, and set up platforms for high-throughput GS phenotyping and for early-stage mutation detection. We expect to develop an improved CRIPSR/Cas9 system for wheat with enhanced editing efficiency, targeting flexibility and accuracy, a panel of novel GS mutations and associated knowledge, a package of novel germplasm with enhanced grain yield potential and functional markers. Thus, this project will significantly contribute to IWYP’s goal to increase wheat yield by 50% by 2034.

Primers used in this study


Gene namePrimer name (F/R)Forward primer (5`-> 3`)Reverse primer (5`-> 3`)
APG-1ASWL3971/WL3972GAGTTGGTGCGTGCGCTAGGACTCGACGGACTTGCTT
APG-1BSWL3973/WL3974CCGTGCTCTTCCTTTTCTTCACCATGTGTCCAGCGCTTT
APG-1DSWL4092/WL4093TGGTGCGCTACTCCTCCTGGTTTCTTGCGAGGGTTGAC
BAS1-3AWL4234/WL4276CACAGCTCAACGAGTGAGTGAGTCTGGGGACGTATGTATGGATGT
BAS1-3BWL4236/WL4237CTATCACAGGACGCCAGGCGAAGAAGAGACAACTCCAAGGT
BAS1-3DSWL4238/WL4239CTCTGTAGCACGCCGCAATGGGAGATCAAGCAAACAAA
CKX2-3.1-3ASWL3901/WL3902CAACGCACGGACACTTAGCCGTGTGCGTACGTAGAAGATGAG
CKX2-3.1-3BSWL4101/WL3904TCCTGTGCTGTGTACCAGAGATGAACGTGATTCCACGCC
CKX2-3.1-3DSWL3905/WL3906CATTTCATTTATCATGACTTCCCGTGCGTGCTTGCCCATATC
CKX2-3.2-3BSWL4082/WL3908CTTTGTGTGTGTAATTTCTCCCGGCTCTAATTAAATACGAAGCGTG
CKX2-3.2-3DSWL3909/WL3910AAGAATCTTTCGTCGGTCCTGGTGAACGAGTTGTGGTTACTTA
CKX2-3.3-3ASWL3911/WL3912TACCTACGCAAGCAGGATGGAGACGAAGACGACGATGACG
CKX2-3.3-3BSWL3913/WL3914TTGCAAGCCCCAATAACGACAGCGTCGAACAGGTCA
CKX2-3.3-3DSWL3915/WL3916GGGTCCCATGTAGTTTACCTTTATAGGCACCATAGGCACGG
CKX2-3.5-3ASWL3919/WL3920AAGACTCACAGGAAGCAAGCTAACGCAAACAAAAGATGATACTCAC
CKX2-3.5-3BSWL3921/ WL3922ACCATCCGAAAGAAAACGAAGCATTAGTACGTGAAGTCGTGAA
CKX2-3.5-3DSWL4056/WL4057CGAACCAGATGGATCCGAGCCATTAGTACGTGAACGTTGGC
DEP1-5ALWL4063/WL4064CGTCCGCCCTTGATTTTCGACCACTAGCCTAGATGCAGGAG
DEP1-5BLWL4003/WL4004TGCACTCGCACTCTCTCTCTAAACAGCACCAACAACTGCTACTACT
DEP1-5DLWL4143/WL4144GCATTTGTTTCCTTGGCACGCTGCCGAGATAAATAACCCTA
EOD1-4ASWL4161/WL4162TGACAAAAGGACCACTTCTGCTCAAACACACTAAAGCACGTCA
EOD1-4BLWL4163/WL4164GTTCCATAGCCGAGGCCCTGATGTGCTGGTGAGCTTTC
EOD1-4DLWL4165/WL4166TTAGAAGAGAGAACCTTTTTAGGACAAAGCCACAAGCCACGTAAT
GL3-5ASWL4062/WL3948ATCGTTTGTGGTTGACCTTTCAGCTAGAAAGTACTGCCGCC
GL3-5DSWL4066/WL3952AGAACTGCCCATGTGACAAAAGGTGAGCAGACTTAGACCGT
GLW7-2ASWL3935/WL3936TATCAATGTTGTGCCTGTTTCTCCAAGTGAAAACCAAATGCTC
GLW7-2BSWL4047/WL4048GCAAGATAAAAACTGGAGGGGCGATAAGGTTTATAAGG
GS2-6ALWL4069/WL3960GATTAATCCTGCAAATCTAGCTGAAAGACAAGGGCTACTGTGC
GS2-6BLWL3961/WL3962TAGCAGCGTCCCTCCTCCGAAAGGGCTACTGTATGGCATGG
GS2-6DLWL3963/WL3964CCTCCTTGTTTGTTTTGCCGCATCTTGGCTTGGCTGTCTT
GW2-6ASWL4007/WL4008CGTGTCACAAAACTAATTGGGCTACGGCAGAACAAATGCAA
GW2-6BSWL4009/WL4010GGGCCAGCAGCAGAGAGACAAACACAGGCACCTAGCAC
GW2-6DSWL4011/WL4012GACATCATACAAGTGGGGAAGGATACGGCAGAACAAATGCAAC
GW7-2DSWL3977/WL4046GCATGTTCTATCTATGAGCGAGTCGACCTAAACTTTGGGAATCTAC
GW7-2ASWL3979/WL3980CTAGCTTCTTGCCCGCAGGTGGTTGTTTCTTACTGGACCTT
GW7-2BSWL3981/WL3982CCGTCCTCTCCTCTCCTCTACAAGGGAAAAACCACTTGATA
GW8-5ALWL3953/WL3954CTCGCATCATAAGAATGGAAGTGGCAGTTCATCTCGTTGTC
GW8-5BLWL3955/WL3956AAATTCAGGGACAAGGTTCGTGCGGTTATTCATTGCTTTC
GW8-5DLWL3957/WL3958GACGTACTGTTCTTCAGTAGCCTCATCTCGTTGTCGTTGGAG
IPA1-ASWL3965/WL3966AGGAGGGTTGCACCAGTTGGCGCAGACTTAGGGTAACGTAG
IPA1-7DSWL3969/WL3970TCTTGCTCTCACCGATCACTACCCGATACTTCAAATTCATGGTT
LP1-3AWL4051/WL4052TAGGAGAATGAGCTGTTTTGAGCAATGTCCAGCCGAGGCT
LP1-3BWL3943/WL3944GGACGGAGGGAGTATTTGACCAAGTGAGAGAACATGGCACT
LP1-3DWL4104/WL3946TAGGAGAATGAGCTGTTTCGACTGGTTTTGTTTGATTCCG
TGW6-3.1-3ALWL4053/WL3984CTCCATGAGCCGGTTGGTTGGACGGACGAATCCACTACTA
TGW6-3.1-3BLWL3985/WL3986CGGGCCCAAACACTTACCCGATCCAGTGCCTTATCAAC
TGW6-3.1-3DLWL3987/WL3988AAGGAAATCCGTCGGGGATCTTTCCATCACCTCAGCG
TGW6-3.3-3ALWL3991/WL3992AAACCCACTCGGCGTCATAATGCCTTAGTAGCTTACATGGG
TGW6-3.3-3BLWL4099/WL3994GGATCAGTGCTACTTGCTATCTCCTCGACTATGTTCCCATCA
TGW6-3.3-3DLWL3995/WL3996TAACCAAGAGTCCAAGAGCCAAGCAATAGTCCATCCGACGAAAAG
TGW6-7.1-7ASWL4015/WL4016TGAATCCATCAAACCAAACCATATTCAATTCTGGGAAGGGAAGAAC
TGW6-7.1-7DSWL4017/WL4018CGCGCCGGGTATAAACTTCCTGTTGGTGAAGCGCAA
TGW6-7.4-7ASWL4145/WL4146AGTGTCCATGCAAGTTTGAATGACCAGCCGAGCTTGTG
TGW6-7.4-7BSWL4110/WL4111GACCAGGTCGAATCGGAACTACGATGACGAGATGTGTCCGA
TGW6-7.4-7DSWL4027/WL4028AAAGAAACCATGAAAAGGAATCGTTTCAAGCTCACACATCTGCT

You can download all the above sequences as a single file from here.